Skip to main content

HomeArrowResearch TopicsArrowStem Cell Research at NIHArrowNIH Stem Cell UnitArrowRT-PCR of Undifferentiated Cells

RT-PCR of Undifferentiated Cells

BG01(1), UC06, WA01, WA07, and WA09 have been tested and found to express Oct-4 and Nanog mRNA in the undifferentiated state. With these Nanog primers, several bands may be observed in different cell lines. As they are located in the 3'UTR, we believe these to be most likely due to a polymorphism.

WA01, WA07 PCR for beta-actin, Oct-4, and Nanog mRNA

1 = WA01, 7 = WA07, M = MEF, - = H20 negative control

RT-PCR Protocol

  • hESC colonies are collected and washed by sedimentation and RNA extracted by standard protocols (Trizol etc).
  • Up to 5μg total RNA is used to make cDNA using the Superscript III system (Invitrogen Cat #18080-044). This is sufficient for 20 PCR reactions.
  • PCR Mix
    cDNA 1μl
    10x PCR Buffer 2.5μl
    50mM MgCl2 0.75μl
    10mM dNTPs 0.5μl
    20μM Forward primer 0.5μl
    20μM Reverse Primer 0.5μl
    H2O 19μl
    5 Units/μl Taq Polymerase 0.25μl
  • Reactions are subjected to 30 PCR cycles after denaturation (4 mins 94°C) as follows: 94°C for 30s; annealing temp for 30s; 72°C for 30s
  • Products are separated on a 2% agarose gel
Gene Forward Primer Reverse Primer Prod. Size Anneal. Temp
Oct-4 cttgctgcagaagtgggtggaggaa ctgcagtgtgggtttcgggca 169bp 55°C
Nanog gcgcggtcttggctcactgc gcctcccaatcccaaacaatacga 426bp 59°C
β-actin cgcaccactggcattgtcat ttctccttgatgtcacgcac 200bp 55°C